• Users Online: 121
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 4  |  Issue : 2  |  Page : 231-235

Genetic variation of pentraxin-3 in Egyptian patients with chronic hepatitis C virus and hepatocellular carcinoma


1 Department of Clinical & Chemical Pathology, Faculty of Medicine for Girls, Al-Azhar University, Cairo, Egypt
2 Department of Clinical & Chemical Pathology, Hematology, Theodor Bilharz Research Institute (TBRI), Ministry of Scientific Research, Giza, Egypt
3 Department of Hepatogastroentrology & Infectious Diseases, Faculty of Medicine for Girls, Al-Azhar University, Cairo, Egypt

Date of Submission19-Mar-2020
Date of Decision08-Apr-2020
Date of Acceptance14-Apr-2020
Date of Web Publication29-Jun-2020

Correspondence Address:
MSc Amira R Harb
Clinical & chemical pathology, Faculty of Medicine, Ain-Shams University, Assistant Researcher of Clinical & chemical pathology, Hematology Department, Theodor Bilharz Research Institute (TBRI) Ministry of Scientific Research, Egypt; Warrak El-Hadar-12411, P.O Box 30 Imbaba, Giza
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/sjamf.sjamf_39_20

Get Permissions

  Abstract 


Background Hepatocellular carcinoma (HCC) is one of the most common aggressive solid malignancies worldwide, particularly in Egypt. There is evidence of the contribution of single nucleotide polymorphisms (SNPs) in increasing cancer risk by influencing individual susceptibility to develop HCC. Pentraxin-3 (PTX3) has several functions in controlling cancer-related inflammation through regulation of the complement cascade, so acting as an extrinsic oncosuppressor gene. Several studies have discussed the association between PTX3 genetic polymorphism and cancer risk.
Aim To study PTX3-(rs2305619)-SNP and the associated risk to develop HCC in patients with chronic hepatitis C virus (HCV), in addition to its possible correlation with HCV-RNA viral load and fibrosis degree in Egyptian patients with chronic HCV and HCC.
Patients and methods A total of 40 patients with HCC on top of chronic HCV infection, 40 patients with chronic HCV, and 40 healthy participants were enrolled in the study. DNA was extracted from the peripheral blood, and PTX3-(rs2305619) genotyping was performed using real-time PCR.
Results PTX3-(rs2305619) A/A polymorphic genotype was statistically significantly higher in both HCC and chronic HCV cases with advanced fibrosis than controls. The A/A genotype showed nine-fold increased risk of HCC when compared with healthy control (odds ratio=9.1, 95% confidence interval=2.304–35.94, P=0.002). A positive correlation was detected between A/A genotype and the higher HCV-RNA viral load in both HCV and HCC patients groups.
Conclusion A allele of PTX3-(rs2305619) SNP could be considered as an independent molecular detector for HCC in Egyptian patients with chronic HCV.

Keywords: chronic liver disease, hepatocellular carcinoma, hepatitis C virus, pentraxin-3, single nucleotide polymorphisms


How to cite this article:
Saleh SA, Zahran NM, El-Zefzafy WM, Mohamed ZA, Mahmoud O, Harb AR. Genetic variation of pentraxin-3 in Egyptian patients with chronic hepatitis C virus and hepatocellular carcinoma. Sci J Al-Azhar Med Fac Girls 2020;4:231-5

How to cite this URL:
Saleh SA, Zahran NM, El-Zefzafy WM, Mohamed ZA, Mahmoud O, Harb AR. Genetic variation of pentraxin-3 in Egyptian patients with chronic hepatitis C virus and hepatocellular carcinoma. Sci J Al-Azhar Med Fac Girls [serial online] 2020 [cited 2020 Oct 23];4:231-5. Available from: http://www.sjamf.eg.net/text.asp?2020/4/2/231/288279




  Introduction Top


Hepatocellular carcinoma (HCC) is the most common major form of primary liver cancers and considered the third leading cause of cancer mortality worldwide [1]. In Egypt, HCC is the sixth most frequent cancer in women and the second most frequent in men [2], with growing incidence mostly owing to the high prevalence of hepatitis B virus (HBV) and hepatitis C virus (HCV), complicated by cirrhosis, as primary and major risk factors for HCC [3].

Development of cancer is related with the accumulation of genetic variations; several studies have demonstrated the contribution of single nucleotide polymorphisms (SNPs) to the predisposition toward HCC [4]. Moreover, a relation between the risk of cancer development and the degree of liver inflammation and fibrosis/cirrhosis was reported [5]. HCV-related hepatic inflammation is regulated by host immune response and mediated by releasing cytokines that play important roles against viral antigens and viral polypeptides, through interactions with cells of innate and adaptive immunity [6].

Pentraxins (PTX) are the main components of soluble arm of humoral innate immunity; they are classified into the short or ‘classical’ PTXs, including C-reactive protein and serum amyloid P component, which are synthesized in the liver and released in the blood during inflammatory conditions in response to interleukin 6, and the long pentraxin-3 (PTX3) [7].

PTX3 gene is located on human chromosome-3; it is one of the pattern-recognition receptors that plays important roles in regulation of inflammation and tissue remodeling through activation and regulation of the complement system (via C1q and factor H) and resistance against selected microbes, being able to interact with microbial moieties [8]. Several theories have demonstrated the link between chronic inflammation caused by infections such as hepatitis or inflammatory conditions (e.g. prostatitis) and the risk to cancer development; the regularity functions of PTX3 in inflammatory conditions suggest its essential role in the control of tumor development [9]. Moreover, emerging evidence revealed an elevated plasma level of PTX3 in many cancers (e.g. liposarcoma, pancreatic carcinoma, lung cancer, prostate carcinoma, glioma, and breast cancer metastasis to bones), in addition to association of PTX3 genetic variation with high protein expression levels and risk to develop HCC in chronically HCV-infected patients [10].


  Patients and methods Top


The current study was conducted on 80 patients with chronic HCV, including 40 patients with chronic HCV with HCC (group I) and 40 patients with chronic HCV without HCC (group II), in addition to 40 healthy individuals as a control group (group III). Patients with chronic HCV were further divided into advanced fibrosis (n=18) and moderate fibrosis (n=22) subgroups, according to fibrosis-4 index for liver fibrosis, which is a noninvasive biochemical method used to evaluate the stages of fibrosis in patients with chronic HCV. It is calculated as follows: age (years)×aspartate aminotransferase (U/l)/[platelet(109/l)×√alanine aminotransferase (U/l)] [11]. Patients were admitted to the Hepatogastroenterology And Infectious Diseases Department of Al-Zahraa University Hospital, Faculty of Medicine, Al-Azhar University, and Hepatology Department of Theodor Bilharz Research Institute (TBRI), Egypt, from March 2018 to June 2019. The research was approved by the Research Ethics Committee of Clinical Pathology Departments, in Faculty of Medicine for Girls, Al-Azhar University (202002133), and TBRI (TBRI-REC number 01/20). We obtained informed consents from all participants according to the Declaration of Helsinki, 1975.

Our inclusion criteria were adult Egyptians more than 18 years old, of both sexes, who had chronic HCV infection. The exclusion criteria were other causes of chronic liver disease, such as history of schistosomiasis, viral hepatitis other than HCV, and malignancies other than HCC. Patients were subjected to history taking, full clinical examination, and routine laboratory investigations. HCC was diagnosed by detection of hepatic focal lesions using abdominal ultrasound and established diagnosis by triphasic computed tomography according to American Association for the Study of Liver Diseases (AASLD) 2011 guidelines [12].

Specimen collection

Under aseptic conditions using vacuum blood collection tubes, 9 ml of peripheral venous blood was collected and distributed as follows: 2.5 ml in EDTA tubes for hemogram, 2.5 ml in another sterile EDTA tube (stored at −80°C) for DNA extraction, 2 ml in sterile citrated tubes for coagulation tests, and 2 ml in a plain tube for serum collection to perform other serological and laboratory tests.

Laboratory investigations

All individuals were subjected to laboratory investigations, including hemogram, using automated cell counter (Celltac-5; Nihon-Kohden, Tokyo, Japan); liver function tests, such as albumin, total bilirubin, alanine aminotransferase, aspartate aminotransferase, and alkaline phosphatase, and alpha fetoprotein using autoanalyzer (Hitachi-736; Hitachi, Japan); and coagulation tests using Stago Compact-Max (Paris, France). HCV-antibodies and HBV-surface antigens were detected by ELISA (Dia-Pro ELISA Kit, Milano, Italy). Quantitative-PCR for detection of HCV-RNA viral load was done using 7500 fast real-time PCR (Applied Biosynthesis, Foster, CA, USA) Kit-24, (#K4518263), Qiagen GmbH (Germany).

DNA extraction and pentraxin-3 genotyping

Genomic DNA was extracted from peripheral blood leukocytes of EDTA tubes using Thermo Scientific (California, USA) GeneJET Whole blood Genomic DNA Purification Mini-Kit (#K0781; Life-Sciences, Canada). Spectrophotometry was used to assess DNA concentration and purity; the samples were stored in the elution buffer at −20°C until being used. PTX3-(rs2305619) SNP in position 157154861A/G, intron-1 location was analyzed by TaqMan allelic discrimination assay Real time PCR amplification of PTX3 SNP was done by (Rotor-Gene Q real time PCR instruments from Qiagen GmbH, QIAGEN Strasse 1, D-40724 Hilden) containing probes for both alleles labeled with either FAM or VIC dyes as follows:

[VIC/FAM]:CCATCCCACTGAGGACCGTAAGTTC[A/G]CTTTAACTGTTTCTCTGCTAACCCT.

Statistical analysis

The statistical analysis of the data was performed using statistical package for social science (SPSS, version 24.0) for Windows (SPSS-IBM, Chicago, Illinois, USA). Normally distributed variables were represented as mean±SD with 95% confidence interval (CI), whereas non-normal variables were summarized as median with 25 and 75 percentile. To compare between groups, Student’s t and Mann–Whitney U tests were performed. χ2 test or Fisher’s exact test was used to determine the distribution of categorical variables between groups. Spearman’s rank correlation coefficient (r) was done. The level of significance was taken at P value of less than or equal to 0.05 and highly significant at P value of less than 0.001.


  Results Top


Patient characteristics

HCC group comprised 31 (77.5%) male and nine (22.5%) female patients and had a mean age of 60.9±5.0 years (range, 51–68 years). HCV group comprised 20 (50%) male and 20 (50%) female patients and had a mean age of 54.1±7.0 years (range, 38–65 years). All patients were HCV positive/HBV negative. Clinical symptoms, signs, and laboratory data of the patients with HCC and those with HCV are summarized in [Table 1].
Table 1 Clinical symptoms, signs, and laboratory findings among the patients with hepatocellular carcinoma and those with hepatitis C virus

Click here to view


Pentraxin-3-(rs2305619) polymorphisms and hepatocellular carcinoma risk

The frequency of the A/A PTX3-(rs2305619) polymorphic genotype in HCC and HCV with advance fibrosis groups was significantly higher when compared with the A/A frequency in controls (P1=0.001 and P4=0.001, respectively) ([Table 2]).
Table 2 Pentraxin-3-(rs2305619) genotyping in the studied groups

Click here to view


Risk estimation revealed that patients carrying A/A PTX3-(rs2305619) genotype had nine times more chance to develop HCC [odds ratio (OR)=9.1, 95% CI=2.304–35.943, P=0.002] when compared with healthy controls in Egyptian populations ([Table 3]).
Table 3 Hepatocellular carcinoma risk estimation

Click here to view


High statistically significant increases in the frequency of A/A genotype were observed when compared with G/A+G/G genotypes in HCC group with high HCV-RNA viral load (P=0.001) and with more advanced fibrosis (P=0.001), whereas there was no statistically significant difference regarding number of focal lesions between A/A and A/G+G/G genotypes in HCC group ([Table 4]).
Table 4 Hepatitis C virus-RNA by PCR, fibrosis-4 score and computed tomographic scan findings in different pentraxin-3-(rs2305619) genotypes in hepatocellular carcinoma patients

Click here to view


The correlation study of pentraxin-3-(rs2305619) genotypes in patients with hepatocellular carcinoma and hepatitis C virus

HCC group showed a significant correlation between A/A genotype and flapping tremors (r=0.345 and P=0.029), alpha fetoprotein (r=0.349 and P=0.027), total bilirubin serum levels (r=0.371 and P=0.018), and HCV-RNA viral load (r=0.757and P=0.001). The same correlation between A/A genotype and HCV-RNA viral load (r=0.518 and P=0.001) was seen in HCV group. However, a significant correlation was detected between the G/G genotype and flapping tremors (r=0.313 and P=0.04) in HCV group ([Table 5]).
Table 5 Correlation study in hepatocellular carcinoma and hepatitis C virus patients

Click here to view



  Discussion Top


PTX3 is an essential component of the humoral immune system, acting as an acute-phase protein that is rapidly expressed by the cells of innate immunity and vascular tissues in response to inflammation. Hepatocarcinogenesis is a multistep process including several consequent genetic variations that control proliferation and/or apoptosis in hepatocytes during the exposure to persistent regenerative and inflammatory stimuli, beginning from the early stages of chronic hepatitis to liver cirrhosis [13]. The aim of the current work was to study PTX3-(rs2305619) SNP and the associated risk to develop HCC in patients with chronic HCV, in addition to its possible correlation with HCV-RNA viral load and fibrosis degree in Egyptian patients with chronic HCV and HCC.

There was a highly significant increase in the frequency of PTX3-(rs2305619) A/A genotype in patients with HCC when compared with both chronic HCV with moderate fibrosis and control groups (P=0.001 and P=0.001, respectively). Patients carrying the A/A genotype almost had nine times more chance to have HCC, (OR=9.1, 95% CI=2.304–35.94, P=0.002) ([Table 2], [Table 3]); thus, HCV-infected patients with A/A genotype may express more pro-inflammatory cytokines than those with G/A or G/G genotypes, which consequently increases the risk to HCC occurrence in patients with chronic HCV. Similar results were reported in the study by Carmo et al. [8], which stated that A/A genotype of PTX3-(rs2305619) was associated with HCC in chronically infected HCV individuals and remained independently correlated with HCC development. The multivariate analysis showed that patients carrying the A/A PTX3-(rs2305619) genotype had almost two times more chance to have HCC (severe fibrosis vs. HCC, OR=1.94, 95% CI=1.09–3.43, P=0.024).

No statistically significant difference was observed regarding the number of hepatic focal lesions in our study in patients with HCC with A/A genotype comparing with those with G/A+G/G genotypes. These results were consistent with a previous study by Carmo et al. [8].

The mechanisms of the possible links between PTX3 and HCC development are still unexplained; studies have demonstrated significant roles of PTX3 as an acute-phase protein and an inflammatory mediator that can bind to several microbes, including fungi, bacteria, and viruses. Moreover, PTX3 facilitates neutrophil infiltration through expression of pro-inflammatory cytokines, such as CCL2, CXCL1, and TNF-α in a model of intestinal ischemia and reperfusion [14], in addition to its key role in dampening cancer-related inflammation, acting as an extrinsic oncosuppressor gene through activation and regulation of classical and lectin complement pathways. PTX3 gene silencing was observed in some human tumors (e.g. colorectal cancer and leiomyosarcoma) [7]. Moreover, PTX3 can promote fibrocyte differentiation at the sites of fibrosis in vitro and in human fibrotic lung tissue [15]. A correlation between PTX3 and more advanced stages of pancreatic carcinoma [16] and bone metastatic breast cancer [17] was reported, and these findings clarify the essential role of PTX3 in tumor occurrence and progression of some types of cancers.There were several limitations within our study. First, the sample size was small, so the association of the PTX3-polymorphism with HCC occurrence needs to be confirmed in a larger sample size. Moreover, prior research studies on the same patient category were nonexistent. Further prospective studies are needed to identify relevant pathways of carcinogenesis and to find different mechanisms that can detect the role of PTX3 genetic variations in HCC development.


  Conclusions Top


In summary, our results support that the frequency of A/A PTX3-(rs2305619) genotype was significantly higher in patients with HCC and chronic HCV-infected patients with advanced fibrosis when compared with control individuals and was positively correlated with high HCV viral load. A allele of PTX3-(rs2305619) SNP might be considered a novel independent molecular detector for HCC among Egyptians.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M et al. Cancer incidence and mortality: sources, methods and major patters in GLOBOCAN. Int J Cancer 2015; 136:E359–E386.  Back to cited text no. 1
    
2.
Attwa MH, El-Etreby SA. Guide for diagnosis and treatment of hepato-cellular carcinoma. World J Hepatol 2015; 7:1632–1651.  Back to cited text no. 2
    
3.
Dai L, Ren P, Liu M, Imai H, Tan EM, Zhang JY. Using immunomic approach to enhance tumor-associated autoantibody detection in diagnosis of hepatocellular carcinoma. Clin Immunol 2014; 152:127–139.  Back to cited text no. 3
    
4.
Dyson J, Jaques B, Chattopadyhay D, Lochan R, Graham J, Das D et al. Hepatocellular cancer: the impact of obesity, type-2 diabetes and a multidisciplinary team. J Hepatol 2014; 60:110–117.  Back to cited text no. 4
    
5.
Baffy G, Brunt EM, Caldwell SH. Hepatocellular carcinoma in non-alcoholic fatty liver disease: an emerging menace. J Hepatol 2012; 56:1384–1391.  Back to cited text no. 5
    
6.
Aroucha DC, do Carmo RF, Moura P, Silva JL, Vasconcelos LR, Cavalcanti MS et al. High tumor necrosis factora/interleukin-10 ratio is associated with hepatocellular carcinoma in patients with chronic hepatitis C. Cytokine 2013; 62:421–425.  Back to cited text no. 6
    
7.
Inforzato A, Doni A, Barajon I, Leone R, Garlanda C, Bottazzi B, Mantovani A. PTX3 as a paradigm for the interaction of pentraxins with the complement system. Semin Immunol 2013; 25:79–85.  Back to cited text no. 7
    
8.
Carmo RF, Aroucha D, Vasconcelos LR, Pereira LM, Moura P, Cavalcanti MS. Genetic variation in PTX3 and plasma levels associated with hepatocellular carcinoma in patients with HCV. J Viral Hepat 2016; 23:116–122.  Back to cited text no. 8
    
9.
Bottazzi B, Inforzato A, Messa M, Barbagallo M, Magrini E, Garlanda C, Mantovani A. The pentraxins PTX3 and SAP in innate immunity, regulation of inflammation and tissue remodeling. J Hepatol 2016; 64:1416–1427.  Back to cited text no. 9
    
10.
Infante M, Allavena P, Garlanda C, Nebuloni M, Morenghi E, Rahal D et al. Prognostic and diagnostic potential of local and circulating levels of pentraxin 3 in lung cancer patients. Int J Cancer 2016; 138:983–991.  Back to cited text no. 10
    
11.
So-Armah KA, Lim JK, Lo Re V, Tate JP, Chang CH, Butt AA et al. FIB-4 stage of liver fibrosis predicts incident heart failure among HIV-infected and uninfected patients. Hepatology 2017; 66:1286–1295.  Back to cited text no. 11
    
12.
Bruix J, Sherman M. American Association for the Study of Liver Diseases (AASLD) practice guidelines. management of hepatocellular carcinoma: an update. Hepatology 2011; 53:1020.  Back to cited text no. 12
    
13.
Tan A, Yeh SH, Liu C-H, Cheung C, Chen P-J. Viral hepatocarcinogenesis: from infection to cancer. Liver Int 2008; 28:175–188.  Back to cited text no. 13
    
14.
Daigo K, Mantovani A, Bottazzi B. The yin-yang of long pentraxin PTX3 in inflammation and immunity. Immunol Lett 2014; 161:38–43.  Back to cited text no. 14
    
15.
Pilling D, Cox N, Vakil V, Verbeek JS, Gomer RH. The long pentraxin PTX3 promotes fibrocyte differentiation. PLoS One 2015; 10:e0119709.  Back to cited text no. 15
    
16.
Kondo S, Ueno H, Hosoi H, Hashimoto J, Morizane C, Koizumi F et al. Clinical impact of pentraxin family expression on prognosis of pancreatic carcinoma. Br J Cancer 2013; 109:739–746.  Back to cited text no. 16
    
17.
Choi B, Lee EJ, Song DH, Yoon S-C, Chung Y-H, Jang Y et al. Elevated Pentraxin 3 in bone metastatic breast cancer is correlated with osteolytic function. Oncotarget 2014; 5:481–492.  Back to cited text no. 17
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusions
References
Article Tables

 Article Access Statistics
    Viewed278    
    Printed30    
    Emailed0    
    PDF Downloaded33    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]